View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_high_43 (Length: 214)
Name: NF6940_high_43
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 13868013 - 13867832
Alignment:
| Q |
19 |
acatctccaacgcgtgcttggacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacgcggag |
118 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13868013 |
acatctccaaggcctgcttcgacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacacggag |
13867914 |
T |
 |
| Q |
119 |
acaatccggtatggtagctgcatgagcgagctggaaaatgaggcagcgatgaccaacacagaactgcaatgtgttgatgtcc |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
13867913 |
acaatccggtgtggtagctgcatgagcgagctggaaactgaggcagcgatgaccaacacagaactgcaacgtgtttatgtcc |
13867832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 11876275 - 11876449
Alignment:
| Q |
19 |
acatctccaacgcgtgcttggacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacgcggag |
118 |
Q |
| |
|
||||||||||||||||||| |||||| ||| |||||| ||||| || ||| ||||| ||||||||||||||| ||||||||||||||||| | || | |
|
|
| T |
11876275 |
acatctccaacgcgtgcttcgacgacctcaaatcttgcaaataagttttgttattgaaacctgggaatccaatcatacgatccttcatgaaatcacgaaa |
11876374 |
T |
 |
| Q |
119 |
acaatccggtatggtagctgcatgagcgagctggaaaatgaggcagcgatgaccaacacagaactgcaatgtgtt |
193 |
Q |
| |
|
| | ||||||||| |||| ||||||||||||||||||||||||| | | ||| |||||||||||||||| |
|
|
| T |
11876375 |
aatttgtggtatggtatctgcgcgagcgagctggaaaatgaggcagcggtcagcaagggagaactgcaatgtgtt |
11876449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 11885896 - 11885722
Alignment:
| Q |
19 |
acatctccaacgcgtgcttggacgacttcagatcttgtgaataatttaagtttttgaaccctgggaatccaatcctacgatccttcatgaaaacgcggag |
118 |
Q |
| |
|
|||||||||| | |||||| ||| | |||| || ||||||||| ||| ||| || |||||||||||||||||| ||||||||| ||||| | |||| |
|
|
| T |
11885896 |
acatctccaatgtgtgcttcgaccaattcaaatattgtgaatacgttaggttcttcaaccctgggaatccaatcaaacgatcctttatgaactcacggat |
11885797 |
T |
 |
| Q |
119 |
acaatccggtatggtagctgcatgagcgagctggaaaatgaggcagcgatgaccaacacagaactgcaatgtgtt |
193 |
Q |
| |
|
|||| |||||||||| || || ||||||||||||| ||| ||| |||||||||||||| ||| ||||| |
|
|
| T |
11885796 |
acaagtcggtatggtatttgtgcgattgagctggaaaatgttgcaatgatcaccaacacagaacttcaacgtgtt |
11885722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University