View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_high_46 (Length: 202)
Name: NF6940_high_46
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 27663046 - 27662873
Alignment:
| Q |
14 |
cagagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagctacgtttcttat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27663046 |
cagagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagctacgtttcttat |
27662947 |
T |
|
| Q |
114 |
gtttcttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27662946 |
gtttcttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaa |
27662873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 103
Target Start/End: Complemental strand, 8310078 - 8309990
Alignment:
| Q |
15 |
agagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagcta |
103 |
Q |
| |
|
|||||||||||||||| |||| | |||| |||||||| ||||| |||||||||||||| | | | |||||||||||||||||| |||| |
|
|
| T |
8310078 |
agagaaacaatttatggtgaaatggttggctgagcgggataatcttgatgaagaagaagtggatcaatgggcgataaacaatgctgcta |
8309990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 8309927 - 8309861
Alignment:
| Q |
118 |
cttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggagg |
184 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
8309927 |
cttgatgatattgagatttcaaatgagaacgtggaggcaatgagagctgatatggaatcaatggagg |
8309861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University