View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_low_40 (Length: 233)
Name: NF6940_low_40
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_low_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 43 - 200
Target Start/End: Complemental strand, 7832590 - 7832433
Alignment:
| Q |
43 |
aaagaggaagattatagaataatggaatgaaagaacacaaaccatgaggcgacagtgactggagccgtaggagataacaatggagaagcttgcgcagagg |
142 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7832590 |
aaagagaaagattatagaataatggaatgaaagaacacaaaccatgaggcgacagtgactggagccgaaggagataacaatggagaagcttgcgcagagg |
7832491 |
T |
 |
| Q |
143 |
aagaagactgaacagtttggcctatgagagaacaataatataaaaattgagagagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
7832490 |
aagaagactgaacagtttggcctatgagagaacaataatataaaaattgtgtgagaga |
7832433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University