View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_low_42 (Length: 227)
Name: NF6940_low_42
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_low_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 47126257 - 47126490
Alignment:
| Q |
1 |
ttacatgatgacaccaataataatttaaga---tgaaataattgaatgtacccacatatgtttggatcgtgtcggacaccaaac----cttcaatctaaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
47126257 |
ttacatgatgacaccaataataatttaagaaaatgaaataattgaatgtacccacatatgtttggatcgtgtcgaacaccaaacacaccttcaatctaaa |
47126356 |
T |
 |
| Q |
94 |
gtgtcggtgatacatagtttattcgataccaaagctaagtctttggttagataaatagcaagaattcaaagagaatggtttcagatggatatgctgttgg |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126357 |
gtgtcggtgatacatagtttattcgacaccaaagctaagtctttggttagataaatagcaaaaattcaaagagaatggtttcagatggatatgctgttgg |
47126456 |
T |
 |
| Q |
194 |
gaattcccttaccagtgagtccaccctccctaga |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47126457 |
gaattcccttaccagtgagtccaccctccctaga |
47126490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University