View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_low_45 (Length: 222)
Name: NF6940_low_45
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 21567188 - 21567386
Alignment:
| Q |
12 |
aacctgtgtgcttttctcaaaacaaccacctccattgttttcagattccttcaacaaaaactcttcaannnnnnncagcaccattgacaacctctgcgca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21567188 |
aacctgtgtgcttttctcaaaacaaccacctccattgttttcagattccttcaacaaaaactcttcaatttttttcagcaccattgacaacctctgcgca |
21567287 |
T |
 |
| Q |
112 |
cttttctcataacaaccaccctcatcaacaatcatcttatgtagagccagtgactcttgtttgatatcttccacactcacatattttagcttttcacag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21567288 |
cttttctcataacaaccaccctcatcaacaatcatcttatgtagagccagtgactcttgtttgatatcttccacactcacatattttagcttttcacag |
21567386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University