View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_low_46 (Length: 218)
Name: NF6940_low_46
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 9800569 - 9800358
Alignment:
| Q |
1 |
acttgctcaccatagaaggtatcaacacatagagactagttcagaattacgatcatattttagaaatggcatcaatcaccatgacatcctcaatcctcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9800569 |
acttgctcaccatagaaggtatcaacacatagagactagttcagaattacgatcatattttagaaatggcatcaatcaccatgacatcctcaatcctcgg |
9800470 |
T |
|
| Q |
101 |
cttcccggctgtaaccaaccagtcatccgtagcatcgcagaggagactcgtcgtcgtcaatgctgtccgagcagttgaaggggaaaagatgatcagatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9800469 |
cttcccggctgtaaccaaccagtcatctgtagcatcgcagaggagactcgttgtcgtcaatgctgtccgagcagttgaaggggaaaagatgatcagatat |
9800370 |
T |
|
| Q |
201 |
gacaacaccaaa |
212 |
Q |
| |
|
||||||| |||| |
|
|
| T |
9800369 |
gacaacagcaaa |
9800358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 26 - 134
Target Start/End: Complemental strand, 9802130 - 9802022
Alignment:
| Q |
26 |
cacatagagactagttcagaattacgatcatattttagaaatggcatcaatcaccatgacatcctcaatcctcggcttcccggctgtaaccaaccagtca |
125 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| | || || || || |||||||||| |||| |
|
|
| T |
9802130 |
cacatagagactagttcagaatccagatcacattgtagaaatggcatcaatcaccatgacatcctcaatggttggttttcccgcggtaaccaaccggtca |
9802031 |
T |
|
| Q |
126 |
tccgtagca |
134 |
Q |
| |
|
|| |||||| |
|
|
| T |
9802030 |
tcggtagca |
9802022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University