View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_low_51 (Length: 203)
Name: NF6940_low_51
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 18927128 - 18926968
Alignment:
| Q |
1 |
acttttaaatttatcctcataacatcaaagtcttgtacacacctaactggtgcaaaatatagtgccacaaccattttgaactctatactctagaccaaaa |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18927128 |
acttttaaatttatcctgataacatcaaagtcttgtacacacctaactggtgcaaaatacagtgccataaccattttgaactctatactctagaccaaaa |
18927029 |
T |
 |
| Q |
101 |
aatctcacattctgtattctagtcagtatcactatctgcaaatatctccggagcaggtgta |
161 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18927028 |
aatctaacattctgtattctagtcggtatcactatctgcaaatatctccggagcaggtgta |
18926968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University