View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6940_low_52 (Length: 202)

Name: NF6940_low_52
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6940_low_52
NF6940_low_52
[»] chr8 (1 HSPs)
chr8 (14-187)||(27662873-27663046)
[»] chr1 (2 HSPs)
chr1 (15-103)||(8309990-8310078)
chr1 (118-184)||(8309861-8309927)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 27663046 - 27662873
Alignment:
14 cagagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagctacgtttcttat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27663046 cagagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagctacgtttcttat 27662947  T
114 gtttcttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaa 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27662946 gtttcttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggaggaaa 27662873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 103
Target Start/End: Complemental strand, 8310078 - 8309990
Alignment:
15 agagaaacaatttatgatgaacttgttgcctgagcggaataattttgatgaagaagaaaggaaacgatgggcgataaacaatgcagcta 103  Q
    |||||||||||||||| |||| | |||| |||||||| ||||| ||||||||||||||  | | | |||||||||||||||||| ||||    
8310078 agagaaacaatttatggtgaaatggttggctgagcgggataatcttgatgaagaagaagtggatcaatgggcgataaacaatgctgcta 8309990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 8309927 - 8309861
Alignment:
118 cttgatgatatacagatttcaaatggcaacgtggaggcaatgagagttgatgtggaatctatggagg 184  Q
    |||||||||||  ||||||||||||  ||||||||||||||||||| |||| ||||||| |||||||    
8309927 cttgatgatattgagatttcaaatgagaacgtggaggcaatgagagctgatatggaatcaatggagg 8309861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University