View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_low_9 (Length: 517)
Name: NF6940_low_9
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 255 - 503
Target Start/End: Original strand, 38662977 - 38663228
Alignment:
| Q |
255 |
gtcgctgcggttgccgcgacaatatcagcaacaattgccattgcaattgctgatttgaactcttttccacaacaaacacaaccgcaaccagaatttccgg |
354 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38662977 |
gtcgctgcggttgccgcgacaatagcagcaacaattggcattgcaattgctgatttgaactcttttccacaacaaacgcaaccgcaaccagaatttccgg |
38663076 |
T |
 |
| Q |
355 |
cgaaagtattgaacttgttggaagcatcgttgttcttgaaactccgatacacacccccttctccggcggtgagaccttctccagcaa---cttaagcaaa |
451 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38663077 |
cgaaagtattgaacttgttggaagcatcgttgttcttgaaactccgatacacaccaccttctccggcggtgagaccttctccagcaacttcttaagcaaa |
38663176 |
T |
 |
| Q |
452 |
agtaatcgactctcttgaagcatttacagtggaacgccaatccacataatct |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38663177 |
agtaatcgactctcttgaagcatttacagtggaacgccaatccacataatct |
38663228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 15 - 214
Target Start/End: Original strand, 38662780 - 38662975
Alignment:
| Q |
15 |
ggacatcaacctaagatttagccctagtatattgtaacaaaaataaagcacataatgaatgtatttaccggtagtagtagagccccaagaatcaatgtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38662780 |
ggacatcaacctaagatttagccctagtatattgtataaaaaataaagcacataatgaatgtatttaccggtagtagtagagccccaagaatcaatgtca |
38662879 |
T |
 |
| Q |
115 |
ccaaagtatcatagaataacttttttgccatgcttttaagcctcttgaacctgctctcaccaacgacagcatttgtcgtcgatgctgctactgacgcagc |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38662880 |
ccaaagtatgatagaataacttttttgccatgcttttaagcctctt----ctgctctcaccaacgacagcatttgtcgtcgatgctgctactgacgcagc |
38662975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University