View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6941_low_7 (Length: 244)
Name: NF6941_low_7
Description: NF6941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6941_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 27 - 226
Target Start/End: Complemental strand, 30399524 - 30399321
Alignment:
| Q |
27 |
acaatcaattagtgaaaccatggaacttacaattttatagagagtatagtaaatataaattggacaataattgattgcgcctagcacacaagctcaatgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30399524 |
acaatcaattagtgaaaccatggaacttacaattttatagagagtatagtaaatataaattggacaataattgattgcgcctagcacacaagctcaatgc |
30399425 |
T |
 |
| Q |
127 |
aatggcgctttctctcttattatgcttgctttatttttacattcaataataatgctatt-ttttatgccat---aatgaaaaatatattaaattagtaga |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30399424 |
aatggcgctttctctcttattatgcttgctttatttttacattcaataataatgctatttttttatgccataggaatgaaaaatatattaaattagtaga |
30399325 |
T |
 |
| Q |
223 |
ctct |
226 |
Q |
| |
|
|||| |
|
|
| T |
30399324 |
ctct |
30399321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University