View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6942_low_7 (Length: 211)

Name: NF6942_low_7
Description: NF6942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6942_low_7
NF6942_low_7
[»] chr3 (2 HSPs)
chr3 (98-206)||(41957823-41957931)
chr3 (1-33)||(41957724-41957756)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 98 - 206
Target Start/End: Original strand, 41957823 - 41957931
Alignment:
98 ctatctggttagttaacgcaactctcattcagaaataaaatttaatctaaagtggcaaaatggaataatattcaacattaacttatcatatcctgatgtc 197  Q
    |||||||||||||||||  | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41957823 ctatctggttagttaacagagctctcattcagaaataaaatttaaactaaagtggcaaaatggaataatattcaacattaacttatcatatcctgatgtc 41957922  T
198 catctcatt 206  Q
      |||||||    
41957923 tgtctcatt 41957931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 41957724 - 41957756
Alignment:
1 cgttatggttcttaaaaaagaatgatggatatg 33  Q
    |||||||||||||||||||||||||||||||||    
41957724 cgttatggttcttaaaaaagaatgatggatatg 41957756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University