View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6944_high_5 (Length: 258)

Name: NF6944_high_5
Description: NF6944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6944_high_5
NF6944_high_5
[»] chr7 (1 HSPs)
chr7 (1-246)||(21400490-21400736)


Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 21400736 - 21400490
Alignment:
1 ttgaagtgtgctacaagaaacgtggttaccctccagggctcaggaccgattcaatcaacatcagtcttgaggaatgcaaagcactcagtgcaatccttag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
21400736 ttgaagtgtgctacaagaaacgtggttaccctccagggctcaggaccgattcaatcaacatcagtcttgaggaatgcaaagctctcagtgcaatccttag 21400637  T
101 gaaatccgatgtcaagaattcagtagataagagtgcaaatcaagctactatttatgagttcacacagtttaaaggtaaactatgtgtgtcttgtaactct 200  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21400636 gaaaaccgatgtctagaattcagtagataagagtgcaaatcaagctactatttatgagttcacacagtttaaaggtaaactatgtgtgtcttgtaactct 21400537  T
201 atcaata-gtaatcttgatagtggggaaacatatcacatatgttttt 246  Q
    ||||||| | |  ||||||||||||||||||||||||||||||||||    
21400536 atcaatatgaacacttgatagtggggaaacatatcacatatgttttt 21400490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University