View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6944_low_10 (Length: 250)
Name: NF6944_low_10
Description: NF6944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6944_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 39669478 - 39669313
Alignment:
| Q |
18 |
acaaagtttgtatagagagctcacccgaagtaaaattatatatggatgcagacatcactagctcactcatgattattaatgttactaaagggatctggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39669478 |
acaaagtttgtatagagagctcacccgaagtaaaattatatatggatgcagacatcactagctcactcatgatttttaatgttactaaagggatctggta |
39669379 |
T |
|
| Q |
118 |
tacatcattctaaacagacaccacaattttcaactcaacaatgtcaccagggcttgttcgatatca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39669378 |
tacatcattctaaacagacaccacaattttcaactcaacaatgtcaccagggcttgttcgatatca |
39669313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 250
Target Start/End: Complemental strand, 39669324 - 39669290
Alignment:
| Q |
216 |
tgttcgatatcacgttccatatcaacgttgggttt |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39669324 |
tgttcgatatcacgttcgatatcaacgttgggttt |
39669290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University