View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6944_low_13 (Length: 227)
Name: NF6944_low_13
Description: NF6944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6944_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 37293264 - 37293467
Alignment:
| Q |
10 |
ctgtcgactttggtggtagattcgtgtatgatcgatttcccaattgcatctctttctatagtagatagatcagcgtcagaattttgtgcaccagaattta |
109 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37293264 |
ctgtcgactctggcggtagattcgtgtatgatcgatttcccaattgcatctctttctatagtagatacatcagcgtcagaattttgtgcaccagaattta |
37293363 |
T |
 |
| Q |
110 |
atggcatctctggtttcagccccttcagatagctacaagttttaattgaatgggagtacgaggagactagtacgtttatagacttggcaaccacaggcac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
37293364 |
atggcatctctggtttcagccccttcagatagctacaagttttaattgaatgggagtacgaggagactagtacatttatagccttggcaaccacaggcac |
37293463 |
T |
 |
| Q |
210 |
aggt |
213 |
Q |
| |
|
|||| |
|
|
| T |
37293464 |
aggt |
37293467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 25 - 112
Target Start/End: Original strand, 48306649 - 48306736
Alignment:
| Q |
25 |
gtagattcgtgtatgatcgatttcccaattgcatctctttctatagtagatagatcagcgtcagaattttgtgcaccagaatttaatg |
112 |
Q |
| |
|
|||||||| |||||||||||||| ||| ||||| | ||||||||| ||||| || ||| |||| ||||||||||||||||| ||||| |
|
|
| T |
48306649 |
gtagattcatgtatgatcgatttttcaactgcatatttttctatagcagatacatgagcatcagcattttgtgcaccagaatctaatg |
48306736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University