View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6944_low_15 (Length: 220)
Name: NF6944_low_15
Description: NF6944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6944_low_15 |
 |  |
|
| [»] scaffold0774 (2 HSPs) |
 |  |
|
| [»] scaffold0442 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0774 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: scaffold0774
Description:
Target: scaffold0774; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 64 - 220
Target Start/End: Complemental strand, 3308 - 3151
Alignment:
| Q |
64 |
ctggtatagtacattc-ttgaccgtgtcctttagactcttataataatgtactacgagagaatcttgaaaatagagggaatagcattgaatggaaatggt |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308 |
ctggtatagtacattcattgaccgtgtcctttagactcttataataatgtacaccgagagaatcttgaaaatagagggaatagcattgaatggaaatggt |
3209 |
T |
 |
| Q |
163 |
aacccaaaagacagatttaaaaagtgcatatattctgatcacactcattctccacttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3208 |
aacccaaaagacagatttaaaaagtgcatatattctgatcacactcattctccacttt |
3151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0774; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 3749 - 3700
Alignment:
| Q |
15 |
tgagaaatgatatttgttcgattattgtgacaattttctctcttatattc |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3749 |
tgagaaatgatatttgttcgattattgtgacaattttctctctcatattc |
3700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0442 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: scaffold0442
Description:
Target: scaffold0442; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 9871 - 9927
Alignment:
| Q |
1 |
ttggaataattgtatgagaaatgatatttgttcgattattgtgacaattttctctct |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
9871 |
ttggaataattgtatgagaaatgatatttgttcgattattgtgacaactttatctct |
9927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0442; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Original strand, 10358 - 10403
Alignment:
| Q |
65 |
tggtatagtacattc-ttgaccgtgtcctttagactcttataataa |
109 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
10358 |
tggtatagtacatccattgaccgtgtcctttagactcttataataa |
10403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University