View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6944_low_3 (Length: 425)
Name: NF6944_low_3
Description: NF6944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6944_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 227 - 415
Target Start/End: Complemental strand, 8524933 - 8524746
Alignment:
| Q |
227 |
cagtctggtcagcgcatctgttttgggtacagagggccataggttcgaatcctgtcaccttgatgtgatgggctgaaagtgcacagcccggcacagcctc |
326 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8524933 |
cagtctggtcagtgcatctgttttgggtacagagggccataggttcgaatcctgttaccttgatgtgatgggctgaaagtgcacaacccggcacagcctc |
8524834 |
T |
|
| Q |
327 |
tttaggctggcgaaatttaggcacaattaattnnnnnnngcaaattaactatattcttcgatccatgctttttgtaacttccacaggtt |
415 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8524833 |
tttagg-tggtgaaatttaggcacaattaattaaaaaaagcaaattaaatatattcttcgatccatgctttttgtaacttccacgggtt |
8524746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 235 - 311
Target Start/End: Complemental strand, 13697019 - 13696943
Alignment:
| Q |
235 |
tcagcgcatctgttttgggtacagagggccataggttcgaatcctgtcaccttgatgtgatgggctgaaagtgcaca |
311 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
13697019 |
tcagcgtatctgttctgggtacagagggccataggttcgaatcctgtcactttgatgtgatgggttgaaagtgcaca |
13696943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 16494912 - 16494945
Alignment:
| Q |
36 |
gcgctcctgcactatacggctttttggcgtcgcc |
69 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
16494912 |
gcgctcctgcactatacggctttttggcatcgcc |
16494945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University