View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6944_low_3 (Length: 425)

Name: NF6944_low_3
Description: NF6944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6944_low_3
NF6944_low_3
[»] chr7 (2 HSPs)
chr7 (227-415)||(8524746-8524933)
chr7 (235-311)||(13696943-13697019)
[»] chr8 (1 HSPs)
chr8 (36-69)||(16494912-16494945)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 227 - 415
Target Start/End: Complemental strand, 8524933 - 8524746
Alignment:
227 cagtctggtcagcgcatctgttttgggtacagagggccataggttcgaatcctgtcaccttgatgtgatgggctgaaagtgcacagcccggcacagcctc 326  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||    
8524933 cagtctggtcagtgcatctgttttgggtacagagggccataggttcgaatcctgttaccttgatgtgatgggctgaaagtgcacaacccggcacagcctc 8524834  T
327 tttaggctggcgaaatttaggcacaattaattnnnnnnngcaaattaactatattcttcgatccatgctttttgtaacttccacaggtt 415  Q
    |||||| ||| |||||||||||||||||||||       ||||||||| ||||||||||||||||||||||||||||||||||| ||||    
8524833 tttagg-tggtgaaatttaggcacaattaattaaaaaaagcaaattaaatatattcttcgatccatgctttttgtaacttccacgggtt 8524746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 235 - 311
Target Start/End: Complemental strand, 13697019 - 13696943
Alignment:
235 tcagcgcatctgttttgggtacagagggccataggttcgaatcctgtcaccttgatgtgatgggctgaaagtgcaca 311  Q
    |||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||    
13697019 tcagcgtatctgttctgggtacagagggccataggttcgaatcctgtcactttgatgtgatgggttgaaagtgcaca 13696943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 69
Target Start/End: Original strand, 16494912 - 16494945
Alignment:
36 gcgctcctgcactatacggctttttggcgtcgcc 69  Q
    |||||||||||||||||||||||||||| |||||    
16494912 gcgctcctgcactatacggctttttggcatcgcc 16494945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University