View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6945_high_7 (Length: 266)
Name: NF6945_high_7
Description: NF6945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6945_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 16386054 - 16385827
Alignment:
| Q |
19 |
gtctgtgctatggcacacacagcataaaatttcatcctcatcgacttcaaattcaatgtcctgtttttgagattgtttttcgattggggtgggtgatggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16386054 |
gtctgtgctatggcacacacagcataaaatttcatcatcatcgacttcaaattcaatgtcctgtttttgagattgtttttcgattggggtggctgatggg |
16385955 |
T |
 |
| Q |
119 |
agagaaggactgtattcgacgttgagatcgatgagcggaacagcgtcgtttgggatgttattgtggtggtgaaggtggggttgaagggcggttattcnnn |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16385954 |
agagaaggactgtattcgacgttgagatcgatgagcggaacagcatcgtttgggatgttattgtggtggtgaaggtggggttgaagggcggttattcttt |
16385855 |
T |
 |
| Q |
219 |
nnnnggtgggtagagaataagtagatgg |
246 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
16385854 |
ttttggtgggtagagaataagtagatgg |
16385827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University