View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6945_low_16 (Length: 229)
Name: NF6945_low_16
Description: NF6945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6945_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 5384784 - 5384590
Alignment:
| Q |
20 |
cagccctgtcatcgtcatccaaccaacataatgttttttatacataaccaatgaagtctcttttacaagctacagaaatcaagaattcnnnnnnngatat |
119 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5384784 |
cagccctgtcatcatcatccaaccaacaaaatgttttttatacataaccaatgaagtctcttttacaagctacagaaatcaagaattcaaaaaaagatat |
5384685 |
T |
 |
| Q |
120 |
gacattgtcaacatcagccaacttggtttttaaatttgatcttaaatgcttcagaagttgaaaattcaaaaagagagaaaaaattgacatctctg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5384684 |
gacattgtcaacatcagccaacttggtttttaaatttgatcttaaatgcttcagaagttgaaaattcaaaaagagagaaaaaattgacatctctg |
5384590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University