View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6945_low_18 (Length: 211)
Name: NF6945_low_18
Description: NF6945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6945_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 33042039 - 33041862
Alignment:
| Q |
19 |
ggttcactttaatttacttgattgctcgcaaatgagaaacacctactaaaatacaataacattttgcactggttaaaattcaatttggtaaagtgatcaa |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33042039 |
ggttcactttaatttacttgattactcgcaaatgagaaacacctactaaaatacaataacattttgcactggttaaaattcaatttggtaaagtgatcaa |
33041940 |
T |
 |
| Q |
119 |
aatcttagaactaacaatgccaaagaatttataatgtttgagcatctgtagacaaagatattcatcatcaattttctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33041939 |
aatcttagaactaacaatgccaaagaatttataatgattgagcatttgtagacaaagatattcatcatcaattttctt |
33041862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University