View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6946_high_11 (Length: 248)
Name: NF6946_high_11
Description: NF6946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6946_high_11 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 71 - 248
Target Start/End: Original strand, 33490825 - 33491002
Alignment:
| Q |
71 |
ggtacttgagaaacgctaaacatcacaaatatgaatgaaccaattacggtgctttatttgcaactcataaaaagtagagtattgatatattgtgatgttt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33490825 |
ggtacttgagaaacgctaaacatcacaaatatgaatgaaccaattacggagctttatttgcaactcataaaaagtagagtattgatatattgtgatgttt |
33490924 |
T |
 |
| Q |
171 |
ttgtactcaaaactcttgtagattccttttatgtaatctttgtttgtttgaaactgtatcagcatgtaataatttctt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
33490925 |
ttgtactcaaaactcttgtagattccttttatgtaatctttgctcgtttgaaactgtatcagcatgtaataatttctt |
33491002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 33490766 - 33490796
Alignment:
| Q |
12 |
tcatcaccattgttgtcttcgttgtccacac |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33490766 |
tcatcaccattgttgtcttcgttgtccacac |
33490796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University