View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6946_high_5 (Length: 309)
Name: NF6946_high_5
Description: NF6946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6946_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 13 - 291
Target Start/End: Complemental strand, 52086957 - 52086679
Alignment:
| Q |
13 |
aaaatcatacagcactaatttacaatgcagcaaaagcatcatccacccatctcttatgttgaacagatgcgtcgccattttcagtattattggcactaga |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52086957 |
aaaatcatacagcactaatttacaaagcagcaaaagcatcatccacccatctcttatgttgaacagatgcgtcgccatttccagtattattggcactaga |
52086858 |
T |
|
| Q |
113 |
gcctaagaatatggctccaacagcagctcgtactttgttcatcctctttcggtgtcgaattcgtcgtagaacaacttctttgtcaagattcttacagttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52086857 |
gcctaagaatatggctccaacagcagcttgtactttgttcatcctctttcggtgtcgaattcgtcgtagaacaacttctttgtcaagattcttacagttc |
52086758 |
T |
|
| Q |
213 |
tcaattggttttaagaacaactgactagtaacgttgaacactgactcttcctcttcttcttcctcaactcccctgtttc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52086757 |
tcaattggttttaagaacaactgactagtaacgttgaacactgactcttcctcttcttcttcctcaactcccctgtttc |
52086679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University