View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6946_low_11 (Length: 273)
Name: NF6946_low_11
Description: NF6946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6946_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 9804582 - 9804528
Alignment:
| Q |
1 |
tgcttcacgttcacaaaccttgaatacttcctttatgggaacgttaatgggtatt |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9804582 |
tgcttcacgttcacaaaccttgaatacttcctttatgggaacgttaatgggtatt |
9804528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University