View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6946_low_5 (Length: 249)
Name: NF6946_low_5
Description: NF6946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6946_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 36452888 - 36452757
Alignment:
| Q |
1 |
taaagttaatattcgaactagtttaaaaatataaaatgacatcaaaaagtatgttgttcattttatatttaatttattttcaagaaaacatgtaatagta |
100 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36452888 |
taaagttaatggtcgaactaacttataaatatgaaatgacatcaaaaagtatgtt---cattttatatttaattttttttcaagaaaacatgtaatagta |
36452792 |
T |
|
| Q |
101 |
gccaggaaagaaaggtataccgactggactccgca |
135 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
36452791 |
gccatgaaagaaaggtataccgactggactccgca |
36452757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 157 - 239
Target Start/End: Complemental strand, 36452765 - 36452683
Alignment:
| Q |
157 |
gactccgcattttttattaagtaccacgatgttcttcaatcttgcaaatgttgaaaagaaagacaaagcatggggaacaacac |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36452765 |
gactccgcattttttattaagtaccacgatgttcttcaatcttgcaaatgttgaaaagaaagacaaagcatggggaacaacac |
36452683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 36452662 - 36452624
Alignment:
| Q |
85 |
aaaacatgtaatagtagccaggaaagaaaggtataccga |
123 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36452662 |
aaaacatgtgatagtagccaggaaagaaaggtataccga |
36452624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University