View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6946_low_6 (Length: 239)
Name: NF6946_low_6
Description: NF6946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6946_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36453202 - 36453424
Alignment:
| Q |
1 |
tactattttgtgaaaattacgtaccatttgactttaacaactcgttttcaatttatgaaagatgttagttttatcgtggttgtgcatttggaaaggttgg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453202 |
tactattttgtgaaaattgcgtaccatttgactttaacaactcgttttcaatttatgaaagatgttagttttatcgtggttgtgcatttggaaaggttgg |
36453301 |
T |
|
| Q |
101 |
cttgaagtaattttattagtgttgatgaaaaggaaaaagaaagaatacgtaacaaaactacattctttaacactagttacttactctatgctagctccca |
200 |
Q |
| |
|
||| ||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36453302 |
ctttaagtaatttcattagcgttgatgaaaaggaaaaataaagaatacgtaacaaaactacattctttaacactagttacttactctatgctagctccca |
36453401 |
T |
|
| Q |
201 |
agcaagaagagtaacggagattg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36453402 |
agcaagaagagtaacggagattg |
36453424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University