View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6948_high_11 (Length: 366)
Name: NF6948_high_11
Description: NF6948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6948_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 19 - 355
Target Start/End: Original strand, 4149389 - 4149725
Alignment:
| Q |
19 |
tgttatacccaatagcttgagcaacatcaatcggcttcccaggaggataaggcctttgccaaaacccccaaatccccaaataaaattgtctagcaaaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4149389 |
tgttatacccaatagcttgagcaacatcaatcggcttcccaggaggataaggcctttgccaaaacccccaaatccccaaataaaattgtctagcaaaatc |
4149488 |
T |
|
| Q |
119 |
ccaaaacttatcttgcgctgcataccgtgactgcgcttttctcggcataggcctcccatcaagcccaataatattgggcactttcttccaaagctctcta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
4149489 |
ccaaaacttatcttgcgctgcataccgtgactgcgcttttctcggcataggcctcccatcaagcccaataatattaggcactttcttccaatgctctcta |
4149588 |
T |
|
| Q |
219 |
tcttcaggcttacgaggtttctcattcttcttcaactcccactcattcaccttatcagctatatactcagctctcatgagcatatgtataactggattgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
4149589 |
tcttcaggcttacgaggtttctcattcttcttcaactcccactcattcaccttatcagctatatactcatatctcatgagcatatgtataattggattgt |
4149688 |
T |
|
| Q |
319 |
tatacatttcgtttataaactcttcgttttcgttcat |
355 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4149689 |
tatacatttcgttcataaactcttcgttttcgttcat |
4149725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University