View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6948_high_31 (Length: 242)
Name: NF6948_high_31
Description: NF6948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6948_high_31 |
 | |
|
| [»] scaffold0543 (1 HSPs) |
| | |
|
| [»] scaffold0492 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 49868075 - 49868289
Alignment:
| Q |
9 |
tgagatgaaaggcattctggaacaaattttggttccttccaatgtctgtcagtgaacttgcttactatattagcctgacaatgatagacacattgaattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49868075 |
tgagatgaaaggcattctggaacaaattttggttccttccgatgtctgtcagtgaacttgcttactatatcagcctgacaatgatagacacattgaattg |
49868174 |
T |
|
| Q |
109 |
tattaaaaataaataaatgtagaagtagaagcctagaaaacaaagggcaatggaacgttaaaaaacctcatgaatgataagagtttgaagtttagggaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49868175 |
tattaaaaataaataaatgtagaagtagaagcctagaaaacaaagggcaatggaacgttaaaaaaccttatgaatgataagagtttgaagtttagggaaa |
49868274 |
T |
|
| Q |
209 |
ttttcaagcagttca |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49868275 |
ttttcaagcagttca |
49868289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 209
Target Start/End: Complemental strand, 39559519 - 39559486
Alignment:
| Q |
176 |
tcatgaatgataagagtttgaagtttagggaaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
39559519 |
tcatgaatgataagagtttgaagtttggggaaat |
39559486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 50815232 - 50815184
Alignment:
| Q |
173 |
acctcatgaatgataagagtttgaagtttagggaaattttcaagcagtt |
221 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
50815232 |
acctcacgaatgataagagtttgaagcttggggaaatttggaagcagtt |
50815184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 221
Target Start/End: Original strand, 50860632 - 50860680
Alignment:
| Q |
173 |
acctcatgaatgataagagtttgaagtttagggaaattttcaagcagtt |
221 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
50860632 |
acctcacgaatgataagagtttgaagcttggggaaatttggaagcagtt |
50860680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0543 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0543
Description:
Target: scaffold0543; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 2368 - 2420
Alignment:
| Q |
169 |
aaaaacctcatgaatgataagagtttgaagtttagggaaattttcaagcagtt |
221 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2368 |
aaaaacctcttcaatgataagagtttgaagtttggggaaattttcaagcagtt |
2420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0492 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0492
Description:
Target: scaffold0492; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 3914 - 3966
Alignment:
| Q |
169 |
aaaaacctcatgaatgataagagtttgaagtttagggaaattttcaagcagtt |
221 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3914 |
aaaaacctcttcaatgataagagtttgaagtttggggaaattttcaagcagtt |
3966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 6688359 - 6688317
Alignment:
| Q |
9 |
tgagatgaaaggcattctggaacaaattttggttccttccaat |
51 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
6688359 |
tgagatgaaaggcattctggaacaatctttggttcctcccaat |
6688317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University