View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6948_low_25 (Length: 273)

Name: NF6948_low_25
Description: NF6948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6948_low_25
NF6948_low_25
[»] chr3 (1 HSPs)
chr3 (1-256)||(53795785-53796040)


Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 53796040 - 53795785
Alignment:
1 taacaataaactaccaacgaaactgaacaaaccgttaccttgttcaccttcggaaacggaaatatcaacgccgttcattgctagaatatcgataaggtca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53796040 taacaataaactaccaacgaaactgaacaaaccgttaccttgttcaccttcggaaacggaaatatcaacgccgttcattgctagaatatcgataaggtca 53795941  T
101 gggtcgttgggaacgataacgtttgctctccggccatcaacggcggttagttgaaggacagaaccgtctttactgaacctaactcgttcaactttaccct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53795940 gggtcgttgggaacgataacgtttgctctccggccatcaacggcggttagttgaaggacagaaccgtctttactgaacctaactcgttcaactttaccct 53795841  T
201 tttttactgcgtttaaaaactcactgtaacgccactggctaccatcggggagatca 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53795840 tttttactgcgtttaaaaactcactgtaacgccactggctaccatcggggagatca 53795785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University