View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6948_low_30 (Length: 247)
Name: NF6948_low_30
Description: NF6948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6948_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 36 - 231
Target Start/End: Original strand, 25602794 - 25602989
Alignment:
| Q |
36 |
gggttataacttataattgaattgaacaaaatttgcataataaattataagggtaattgagtatacctctaaccgggaaaatgttgattgcgatttgtag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25602794 |
gggttataacttataattgaattgaacaaaatttgcataataaattataagggtaattgagtttacctctaaccgggaaaatgttgattgcgatttgtag |
25602893 |
T |
|
| Q |
136 |
gaaccatgtgtcaatgttggattgaagaactcaattgaaagaaaaactgtggaaacaacacgatctagaaagagacaactcttgaaagattaagac |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25602894 |
gaaccatgtgtcaatgttggattgaagaactcgattgaaagaaaaactgtggagacaacacgatctagaaagagacaactcttgaaagattaagac |
25602989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University