View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6948_low_38 (Length: 229)
Name: NF6948_low_38
Description: NF6948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6948_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 43615347 - 43615543
Alignment:
| Q |
17 |
aaattgaaagggaatagaaagcctagagagtacatgtatatcagccaaaaattattagatatgattgttgaattttacatcatcatcaattcaatgggat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43615347 |
aaattgaaagggaatagaaagcctagagagtacatgtatatcagccaaaaattattagatatgattgttgaattttacatcatcattaattcaatgggat |
43615446 |
T |
 |
| Q |
117 |
gacctataccatgctatgctatagggttgagacaaatacgttagacatggacttcaatttgtaaaggccccaccaagtatatactccaacagatatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615447 |
gacctataccatgctatgctatagggttgagacaaatacgttagacatggacttcaatttgtaaaggccccaccaagtatatactccaacagatatt |
43615543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University