View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6948_low_40 (Length: 223)
Name: NF6948_low_40
Description: NF6948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6948_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 26828586 - 26828437
Alignment:
| Q |
1 |
tcagttagattttgttgttacaacttgttgagtttgttatcaactagctagtccttctcttgtatcattagttttattgatta---tactgcaaataaaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26828586 |
tcagttagattttgttgttacaacttgttgagtttgttatcaactagctagtccttctcttgtatcattagttttattgattatactactgcaaataaaa |
26828487 |
T |
|
| Q |
98 |
taac-----aagagagcgattgacaaagaaaactcaaaaatttgcaggac |
142 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26828486 |
taacaaggaaagagagcgattgacaaagaaaactaaaaaatttgcaggac |
26828437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 26828429 - 26828391
Alignment:
| Q |
172 |
atcagaatttccttcagcagtttcttaacaatttacaca |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
26828429 |
atcagattttccttcagcagtttcttaacaatttgcaca |
26828391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University