View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6949_high_10 (Length: 257)
Name: NF6949_high_10
Description: NF6949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6949_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 36230362 - 36230228
Alignment:
| Q |
1 |
taaaatattttgtgtaggcacaagcccacacaacaatatgcatgcattcatccctcattatgacttcacaatttccatgcttgttttccc-tttgcattc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36230362 |
taaaatattttgtgtaggcacaagcccacacaacaatatgcatgcattcatcccaaattatgacttcacaatttccatgcttgttttcccttttgcattc |
36230263 |
T |
 |
| Q |
100 |
tcttatt------agtccacagtcaaatttcttat |
128 |
Q |
| |
|
||||||| |||||||| ||||||||||||| |
|
|
| T |
36230262 |
tcttatttataagagtccacaatcaaatttcttat |
36230228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 46695790 - 46695760
Alignment:
| Q |
1 |
taaaatattttgtgtaggcacaagcccacac |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46695790 |
taaaatattttgtgtaggcacaagcccacac |
46695760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 32
Target Start/End: Original strand, 27818751 - 27818781
Alignment:
| Q |
2 |
aaaatattttgtgtaggcacaagcccacaca |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27818751 |
aaaatattttgtgtaggcacaagcccacaca |
27818781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University