View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6950_high_20 (Length: 210)

Name: NF6950_high_20
Description: NF6950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6950_high_20
NF6950_high_20
[»] chr4 (1 HSPs)
chr4 (17-210)||(27878114-27878307)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 27878114 - 27878307
Alignment:
17 caagagccactttctcagacatctttgtcaacttcttaacactgnnnnnnntcccacatacataacatcatcaaaattgcataaaacacgaaacaaaaca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
27878114 caagagccactttctcagacatctttgtcaacttcttaacactgaaaaaaatcccacatacataacatcatcaaaattgcataaaacacgaaacaaaaca 27878213  T
117 ttcagcgatagaaatttttcaaatttcttaccttttcatactattcagggcaagtggactaatctgtgattgagaagaaccaggttgcaacctc 210  Q
    ||||| ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27878214 ttcagtgatagatttttttcaaatttcttaccttttcatactattcagggcaagtggactaatctgtgattgagaagaaccaggttgcaacctc 27878307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University