View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6950_high_5 (Length: 363)
Name: NF6950_high_5
Description: NF6950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6950_high_5 |
 | |
|
| [»] scaffold0025 (3 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 82 - 356
Target Start/End: Complemental strand, 27231539 - 27231265
Alignment:
| Q |
82 |
acttgcataccaagtaaactcatatgcatatcttacaccctacaaacccaaccctcctgcgcggaggaggcgaagctgaaacatgcaaacacaatagatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27231539 |
acttgcataccaagtaaactcatatgtttatcttacaccctacaaacccaaccctcctgcgcggaggaggcgaaactgaaacatgcaaacacaatagatc |
27231440 |
T |
|
| Q |
182 |
cagtgatggaatcacaaacaaccaaccagaaaacaccagacccaacacaacaac-atgacctccgcaaacctttgaacgcactgcaaacgaggacgattg |
280 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27231439 |
cagtgatcgaatcacaaacaaccaaccagaaaaca-aagacccaacacaacaactatgacctccgcaaacctttgaacg-actgcaaacgaggacgattg |
27231342 |
T |
|
| Q |
281 |
aaacatgctggaggtcggatcgctgaaaagagaaggttgtga-ggtgtggtggaggaaagatctcattgcaacacca |
356 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |||| |||||| |||||||||||||| ||||| |
|
|
| T |
27231341 |
aaacatgccggaggtcggatcgctgaaaagagaagggtgtgatggtggtgtggagataagatctcattgcaccacca |
27231265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 190 - 292
Target Start/End: Complemental strand, 27237330 - 27237229
Alignment:
| Q |
190 |
gaatcacaaacaaccaaccagaaaacaccagacccaacacaacaacatgacctccgcaaacctttgaacgcactgcaaacgaggacgattgaaacatgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| |||| ||||| || ||||| || |||||||||| |
|
|
| T |
27237330 |
gaatcacaaacaaccaaccagaaaacaccaaacccaacacaacaacgtgacctctgcaaacctttaaacg-actgcgaatgaggatgaccgaaacatgct |
27237232 |
T |
|
| Q |
290 |
gga |
292 |
Q |
| |
|
||| |
|
|
| T |
27237231 |
gga |
27237229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 181
Target Start/End: Complemental strand, 27237886 - 27237828
Alignment:
| Q |
123 |
acaaacccaaccctcctgcgcggaggaggcgaagctgaaacatgcaaacacaatagatc |
181 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
27237886 |
acaaacccaaccctcctgcacggaggaggggaagttgaaacatgtaaacacaatagatc |
27237828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 90
Target Start/End: Complemental strand, 27232579 - 27232524
Alignment:
| Q |
36 |
atattattgcttaatgacttg-ctatatacatagccttattacaatgacttgcata |
90 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
27232579 |
atattattgcttaatgacttggctatatacataaccttattagaatgacttgcata |
27232524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 65 - 126
Target Start/End: Original strand, 58101 - 58162
Alignment:
| Q |
65 |
atagccttattacaatgacttgcataccaagtaaactcatatgcatatcttacaccctacaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
58101 |
atagccttattacaatgacttgcataccaagtaaactcatatgcatatcctacaccttacaa |
58162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 59 - 125
Target Start/End: Original strand, 62550 - 62616
Alignment:
| Q |
59 |
atatacatagccttattacaatgacttgcataccaagtaaactcatatgcatatcttacaccctaca |
125 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
62550 |
atatatatagccttattacaattacttgcataccaagtaaactcatatgcatatcctacaccttaca |
62616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 60 - 106
Target Start/End: Original strand, 62507 - 62553
Alignment:
| Q |
60 |
tatacatagccttattacaatgacttgcataccaagtaaactcatat |
106 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
62507 |
tatatatagccttattacaattacttgcataccaagtaaactcatat |
62553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University