View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6950_high_6 (Length: 333)
Name: NF6950_high_6
Description: NF6950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6950_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 11312688 - 11312384
Alignment:
| Q |
18 |
acaaaatgcccaaaaggaagaagagaagagcttaatagagcatgctcaagctttctttagtcaaagaggaagaggtcgaggtcgaagcggacttggcggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11312688 |
acaaaatgcccaaaaggaagaagagaagagcttaatagagcatgctcaagctttctttagtcaaagaggaagaggtcgaggtcgaagcggacgtggcggt |
11312589 |
T |
 |
| Q |
118 |
agaggtcactttaactctcaaggaagaggttttactccagtaggtcgatataatggacctcaaaacaacgaggtcttcgtcaagcataaccacagttcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
11312588 |
agaggtcactttaactctcaaggaagaggttttactccagcaggtcgatataatggacctcaaaacaacgagttctctgtcaagcataaccacagttcaa |
11312489 |
T |
 |
| Q |
218 |
agggagaaaagccacgtcaaatcaacgagagtaaaagtgcttgtcaaatttgcataaaattgaatcatgaagctgttgattgctggtacaggtatgatta |
317 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312488 |
agggagaaaagccacgtcaaaacaacgagagtaaaagtgcttgtcaaatttgcagaaaaccgaatcatgaagctgttgattgctggtacaggtatgatta |
11312389 |
T |
 |
| Q |
318 |
ttctt |
322 |
Q |
| |
|
||||| |
|
|
| T |
11312388 |
ttctt |
11312384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University