View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6950_high_9 (Length: 271)

Name: NF6950_high_9
Description: NF6950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6950_high_9
NF6950_high_9
[»] chr3 (2 HSPs)
chr3 (17-126)||(42113040-42113149)
chr3 (203-254)||(42113246-42113297)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 17 - 126
Target Start/End: Original strand, 42113040 - 42113149
Alignment:
17 ctcttatccccgctgtcccatccggcccataattaaaccctatctatgccttcttttcattctcataacaactttcttattcatctcccatgcttaacct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42113040 ctcttatccccgctgtcccatccggcccataattaaaccctatctatgccttcttttcattctcataacaactttcttattcatctcccatgcttaacct 42113139  T
117 cactctctct 126  Q
    ||||||||||    
42113140 cactctctct 42113149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 203 - 254
Target Start/End: Original strand, 42113246 - 42113297
Alignment:
203 ccaccatccaacatctttttgtggggtaatcttaattatcaatgatttatgt 254  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||    
42113246 ccaccatccaacatctttttgtgtggtaatcttaattatcaatgatttatgt 42113297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University