View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6950_high_9 (Length: 271)
Name: NF6950_high_9
Description: NF6950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6950_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 17 - 126
Target Start/End: Original strand, 42113040 - 42113149
Alignment:
| Q |
17 |
ctcttatccccgctgtcccatccggcccataattaaaccctatctatgccttcttttcattctcataacaactttcttattcatctcccatgcttaacct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42113040 |
ctcttatccccgctgtcccatccggcccataattaaaccctatctatgccttcttttcattctcataacaactttcttattcatctcccatgcttaacct |
42113139 |
T |
|
| Q |
117 |
cactctctct |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
42113140 |
cactctctct |
42113149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 203 - 254
Target Start/End: Original strand, 42113246 - 42113297
Alignment:
| Q |
203 |
ccaccatccaacatctttttgtggggtaatcttaattatcaatgatttatgt |
254 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42113246 |
ccaccatccaacatctttttgtgtggtaatcttaattatcaatgatttatgt |
42113297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University