View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6950_low_20 (Length: 227)
Name: NF6950_low_20
Description: NF6950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6950_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 39702991 - 39703185
Alignment:
| Q |
15 |
ctgtgctgtggctacttttgttggtgtggttgnnnnnnngtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttggga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39702991 |
ctgtgctgtggctacttttgttggtgtggttgtttttttgtcgggttatcgattttatcgagccgaaaagcctcaaggaagtgcggttttggatttggga |
39703090 |
T |
|
| Q |
115 |
cgtgtttttgttgcatctgttcggaagtggaagtgtaagctctcatctagagttgaggattactatgtcagttcttcttgttgtggtgattctat |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39703091 |
cgtatttttgttgcatctgttcggaagtggaagtgtaagctctcatctagagttgaggattactatgtcagttcttctggttgtggtgattctat |
39703185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 15 - 180
Target Start/End: Original strand, 39693018 - 39693183
Alignment:
| Q |
15 |
ctgtgctgtggctacttttgttggtgtggttgnnnnnnngtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttggga |
114 |
Q |
| |
|
||||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693018 |
ctgtgttgtggctgcttttgttggtgtggttatttttttgtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttggga |
39693117 |
T |
|
| Q |
115 |
cgtgtttttgttgcatctgttcggaagtggaagtgtaagctctcatctagagttgaggattactat |
180 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39693118 |
cgtgtttttgttgcatctgttcgtaagtggaagtgtaagctctcatctagagttgaggattactat |
39693183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 39930307 - 39930132
Alignment:
| Q |
16 |
tgtgctgtggctacttttgttggtgtggttgnnnnnnngtcgggttatcgattttatcgagccgaaaagcttcaaggaagtgcggttttggatttgggac |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||||||| || ||||||||| ||||||| ||||||| |
|
|
| T |
39930307 |
tgtgctgtggctgcttttgttggtgtggttgtttttgtgttaggttatcgattttatcgggccgaaaagccacagggaagtgcgattttggacttgggac |
39930208 |
T |
|
| Q |
116 |
gtgtttttgttgcatctgttcggaagtggaagtgtaagctctcatctagagttgaggattactatgtcagttcttc |
191 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| ||||||||| ||||| |||| |||||||||||||| |||||||| |
|
|
| T |
39930207 |
gtgtttttgttgcatctgctcgtaagtggaggtgtaagctttcatccagagctgaggattactatggtagttcttc |
39930132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University