View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6951_high_12 (Length: 267)
Name: NF6951_high_12
Description: NF6951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6951_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 39 - 257
Target Start/End: Complemental strand, 53005925 - 53005707
Alignment:
| Q |
39 |
gatcagtaagcaattgactatactaagatgtcaaatagcgtcctgttcagcattaagtgacaaagtttagcagcaaatattatgtgcactgtaactacat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53005925 |
gatcagtaagcaattgactatactaagatgtcaaatagcgtcctgttcagcattaagtgacaaagtttagcagcaaatactatgtgcactgtaactacat |
53005826 |
T |
 |
| Q |
139 |
ggtttaacggtcaccaaacttcaaaacagaagctgaactgattgcataattaacatagtttccaagcatttagtagatacaatgagttgcagtgtaaggt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53005825 |
ggtttaacggtcaccaaacttcaaaacagaagctgaactgattgcataattaacatagtttccaagcatttagtagatacaatgagttgcagtgtaaggt |
53005726 |
T |
 |
| Q |
239 |
tttaatctgatgcttcttc |
257 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53005725 |
tttaatctgatgcttcttc |
53005707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University