View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6952_low_9 (Length: 313)
Name: NF6952_low_9
Description: NF6952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6952_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 48780051 - 48779787
Alignment:
| Q |
7 |
tggacatcaatgcttcttcggatggcagtgaagcctgaagttcacatatttactatagacattatttcagctttagctttgcgttctagtcacagattgc |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48780051 |
tggacaacaatgcttcttcggatggcagtgaagcctgaagttcacatatttactatagacattatttcagctttagctttgcgttctagtcacagattgc |
48779952 |
T |
 |
| Q |
107 |
aggtagccgcttggctctatttgtcgatacttttacacaaattatcagattaagaaatacaactgttgacattcgtgaactagaaattagcaaatgtttc |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48779951 |
aagtagccgcttggctctatttgtcgatacttttacacaaattatcagattaagaaatacaactgttgacattcgtgaactagaaattagcaaatgtttc |
48779852 |
T |
 |
| Q |
207 |
cctcatcctcttaatattctttgcatgaagattctaaattttgttatatatgcttccatattctt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48779851 |
cctcatcctcttaatattctttgcatgaagattctaaattttgttatatatgcttccatattctt |
48779787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University