View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6954_high_15 (Length: 275)
Name: NF6954_high_15
Description: NF6954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6954_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 26828871 - 26828628
Alignment:
| Q |
17 |
attattagaggcagttgccacactcaactgtttactgctgtttgcggttttccacccctgcagcaagtgcctcgcgtgctctggaatagtttgacagttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26828871 |
attattagaggcagttgccacactcaactgtttactgctgtttgcggttttccacccctgcagcaagtgcctcgcgtgctctggaatagtttgacagttt |
26828772 |
T |
 |
| Q |
117 |
tcagttacattttgtattttatttggttctttattgttctattggaaaaataagaaacatttcattgtgtcacaatcttctccgaggatgagtatatggt |
216 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26828771 |
tcagttacattttgtattttctttgattctttattggtctattggaaaaataagaaacatttcattgtgtcacaatcttctccgaggatgagtatatggt |
26828672 |
T |
 |
| Q |
217 |
tattgcagattcctcatccatcacttgtcattgtataatatgat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26828671 |
tattgcagattcctcatccatcacttgtcattgtataatatgat |
26828628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University