View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6954_high_9 (Length: 378)
Name: NF6954_high_9
Description: NF6954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6954_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 49 - 355
Target Start/End: Original strand, 10690237 - 10690546
Alignment:
| Q |
49 |
tcattctttggattactactagtttgctccttagatacaattctaaacatggactttttcgcagaaaatacttcaccaattagttgtgtatctttcgcgg |
148 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690237 |
tcattatttagattactactagtttgctccttagatacaattctaaacatggactttttcgcagaaaatacttcaccaattagttgtgtatctttcgcgg |
10690336 |
T |
 |
| Q |
149 |
aaccagcagagggagaaacctcat---catcatcatcagtgaggtcttcaacattttcccgcttcaactgctctcccctaagttctgatggtgtctttct |
245 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10690337 |
aaccagcagagggagaaacctcatcatcatcatcatcagtgaggtcttcaacactttcccgcttcaactgctctcccctaagttctgatggtgtctttct |
10690436 |
T |
 |
| Q |
246 |
tttaaccatggaagaaattccatgagaacttggaggtgctgctactttttccatgcagagaattggtctcaagaataatctttgtagaagcaagggaaac |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10690437 |
tttaaccatggaagaaattccatgagaacttggaggtgctgctactttttccatgcagagaattggtctcaagaataatctttgtagaagcgagggaaac |
10690536 |
T |
 |
| Q |
346 |
aattaagcca |
355 |
Q |
| |
|
|||||||||| |
|
|
| T |
10690537 |
aattaagcca |
10690546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University