View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6954_low_16 (Length: 300)
Name: NF6954_low_16
Description: NF6954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6954_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 26216371 - 26216518
Alignment:
| Q |
18 |
cgatttgcgcaaggaaggctattaatttacttggttccattttattggcacagagcacacagtggaggtaaaacttgatagagcacgcaccgatggtgat |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
26216371 |
cgatttgcgcatggaaggctattaatttacttggttccattttattggcacagagcacacagtggaggtaaaactggatagagcacgcaccaatggtgat |
26216470 |
T |
 |
| Q |
118 |
ttgtgtcatacatttcctaatgcacatctagaatgcttgacaactact |
165 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216471 |
ttgtgtcaaacatttcctaatgcacatctagaatgcttgacaactact |
26216518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 167 - 288
Target Start/End: Original strand, 26216551 - 26216672
Alignment:
| Q |
167 |
tgatccgatcaggacttctatgagttcaatgcggcggttcaagtttgaaaatgctttgttggaagaaccaggctttgaggattttgagtcaatgttggca |
266 |
Q |
| |
|
|||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26216551 |
tgatcccatcagtacttctatgagttcaacgcggcggttcaagtttgaaaatgctttgttggcagaaccaggctttgaggattttgagtcaatgttggca |
26216650 |
T |
 |
| Q |
267 |
tatctaaaatggagttaatatt |
288 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
26216651 |
tatctcaaatggagttaatatt |
26216672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University