View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6954_low_18 (Length: 277)
Name: NF6954_low_18
Description: NF6954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6954_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 7729881 - 7729640
Alignment:
| Q |
17 |
gtgcaaacgtgatagctagcttgagagcttgtaaggcttcagttgtagagggactccatacgaatgcttccttcttcaagattttagttaatggagtggt |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||| ||| |
|
|
| T |
7729881 |
gtgcagacgtgatagctagcttgagagcttgtaaggcttcagttgtagaggaactccatacgaacgcttccttcttcaagagtttagttaatggagcggt |
7729782 |
T |
 |
| Q |
117 |
aattgtggaataatggcacacaaatcttctatagtaaccggatagtcctaagaaagccacacaattgttttagatttgtaggagtaggccaatcaaggat |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7729781 |
aattgtagaataatggcacacaaatcttctatagtaaccggagagtcctaag-aagccacacaattgttttagatttgtaggagtaggccaatcaaggat |
7729683 |
T |
 |
| Q |
217 |
tgcctgaaccttggtcttgtccatctaaatggcttgattggaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7729682 |
tgcctgaaccttggtcttgtccatctaaatgccttgattggaa |
7729640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University