View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6954_low_28 (Length: 231)
Name: NF6954_low_28
Description: NF6954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6954_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 13803868 - 13804086
Alignment:
| Q |
3 |
tgtaagaatacccaagtaatgctacaatgatggattgaaactaaatatttccccaaacctatctaccaagactctaggcctagtactatcgattacttat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13803868 |
tgtaagaatacccaagtaatgctacaatgatggattgaaactaaatatttccccaaacctacctaccaagactctaggcctagtactatcgattacttat |
13803967 |
T |
|
| Q |
103 |
tttccttttactttcctatgcatattgtgccttacgacaaatggggagatacacaaaatctaccaatgccaactatcaatttaaggaaaagtatatctca |
202 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13803968 |
tttccttttactttcctatgcatattgaaccttacaacaaatggggagatgcacaaaatctaccaatgccaactatcaatttaaggaaaagtatatctca |
13804067 |
T |
|
| Q |
203 |
aactccattgatgtccatc |
221 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
13804068 |
aactccattgatttccatc |
13804086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University