View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6955_high_5 (Length: 240)
Name: NF6955_high_5
Description: NF6955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6955_high_5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 38870860 - 38871083
Alignment:
| Q |
17 |
agcacttacattatggtgtttggttgtgaagaaaaagcgacaggatagacgagaaagagtatgaaaggggggatatgaatgagaaaatgttgaaattggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38870860 |
agcacttacattatggtgtttggttgtgaagaaaaagcgacaggatagacgagaaagagtatgaaaagggggatatgaatgagaaaatgttgaaattggc |
38870959 |
T |
 |
| Q |
117 |
tcaaaattttgttatgaagttaatggaaaaattgtgacgtgatttaatgcagctgtttttcatgttttttattcttctaaaattgtggcacggttggttg |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38870960 |
tcaaaattttgtgatgaagttaatggaaaaattgtgacgtgatttaatgcagctgtttttcatgttttttattcttataaaattgtggcacggttggttg |
38871059 |
T |
 |
| Q |
217 |
aagttgaaatcgtggcacgacttt |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38871060 |
aagttgaaatcgtggcacgacttt |
38871083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University