View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6955_high_6 (Length: 239)
Name: NF6955_high_6
Description: NF6955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6955_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40378885 - 40378666
Alignment:
| Q |
1 |
taagtatatggtcttcttaatatctctgaattatattaagttttcctctcaactttttattattattattaagtgctttaaaaaatataagtaaatttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40378885 |
taagtatatggtcttcttaatatctctgaattatattaagttttcccctcaactttttattattatta---agtgctttaaaaaatataagtaaatttcg |
40378789 |
T |
|
| Q |
101 |
agaataagattatatagctattcttgtcc-nnnnnnnngagattatatagctattatttaagaaaagaagaagattatatagctataaattttgaattta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40378788 |
agaataagattatatagctattcttgtccaaaaaaaaaaagattatatagctattatgtaagaaaagaagaagattatatagctataaattttgaattta |
40378689 |
T |
|
| Q |
200 |
tataaaattttgtcgtatgcttt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40378688 |
tataaaattttgtcgtatgcttt |
40378666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University