View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6956_low_10 (Length: 239)

Name: NF6956_low_10
Description: NF6956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6956_low_10
NF6956_low_10
[»] chr8 (1 HSPs)
chr8 (17-213)||(31673825-31674026)
[»] chr4 (1 HSPs)
chr4 (200-232)||(5448622-5448654)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 31674026 - 31673825
Alignment:
17 aattctatgatttcatttttagatcacttggggttaatcttacatagcatatactcatacttgcatgtctattcgtgggacggcatataag-ccaaaaat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
31674026 aattctatgatttcatttttagatcacttggggttaatcttacatagcatatactcatacttgcatgtctattcgtgggacggcatataagcccaaaaat 31673927  T
116 tcctat----tacgtagtagtgactagttaagcttaataatttgttaattaattgctacaactttgactttggcaacatactcttttatactcgctccgt 211  Q
     |||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31673926 ccctattacgtacgtagtagtgactagttaagcttaataatttgttaattaattgctacaactttgactttggcaacatactcttttatactcgctccgt 31673827  T
212 cc 213  Q
    ||    
31673826 cc 31673825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 5448622 - 5448654
Alignment:
200 tactcgctccgtcccttaatgtagtcatccatt 232  Q
    |||||||||||||||||||||||| ||||||||    
5448622 tactcgctccgtcccttaatgtaggcatccatt 5448654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University