View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6956_low_10 (Length: 239)
Name: NF6956_low_10
Description: NF6956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6956_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 31674026 - 31673825
Alignment:
| Q |
17 |
aattctatgatttcatttttagatcacttggggttaatcttacatagcatatactcatacttgcatgtctattcgtgggacggcatataag-ccaaaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31674026 |
aattctatgatttcatttttagatcacttggggttaatcttacatagcatatactcatacttgcatgtctattcgtgggacggcatataagcccaaaaat |
31673927 |
T |
|
| Q |
116 |
tcctat----tacgtagtagtgactagttaagcttaataatttgttaattaattgctacaactttgactttggcaacatactcttttatactcgctccgt |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31673926 |
ccctattacgtacgtagtagtgactagttaagcttaataatttgttaattaattgctacaactttgactttggcaacatactcttttatactcgctccgt |
31673827 |
T |
|
| Q |
212 |
cc |
213 |
Q |
| |
|
|| |
|
|
| T |
31673826 |
cc |
31673825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 5448622 - 5448654
Alignment:
| Q |
200 |
tactcgctccgtcccttaatgtagtcatccatt |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
5448622 |
tactcgctccgtcccttaatgtaggcatccatt |
5448654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University