View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6956_low_11 (Length: 232)
Name: NF6956_low_11
Description: NF6956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6956_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 217
Target Start/End: Original strand, 36489588 - 36489788
Alignment:
| Q |
13 |
cctgtgcgagagagcttcttactattcttaacaagaagaattaagcttccacaaccgattcttaatatagttaaagatcgatttttcgcttctacctatc |
112 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36489588 |
cctgttcgagagagcttcttactattc----caacaagaattaagcttccacaaccgattcttaatgtagttaaagatcgatttttcgcttctacctatc |
36489683 |
T |
 |
| Q |
113 |
atagattggagcccaagatattttccggagctcatgcactttggctcttgtaaaatattagagagcgtggaggaatatttctactaaagaaaatctcata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36489684 |
atagattggagcccaagatattttccggagcccatgcactttggcacttgtaaaatattagagagcgtggaggaatatttctactaaagaaaatctcata |
36489783 |
T |
 |
| Q |
213 |
ttttt |
217 |
Q |
| |
|
||||| |
|
|
| T |
36489784 |
ttttt |
36489788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University