View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6956_low_5 (Length: 264)
Name: NF6956_low_5
Description: NF6956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6956_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 135 - 247
Target Start/End: Original strand, 28232679 - 28232791
Alignment:
| Q |
135 |
tggagagccaagatcatcttacaccatcacacgtggatgcatctcgaccatcccttggtttccctttgggcactgcccttctcttgatcatcatttttag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232679 |
tggagagccaagatcatcttacaccatcacacgtggatgcatctcgaccatcccttggtttccctttgggcactgcccttctcttgatcatcatttttag |
28232778 |
T |
|
| Q |
235 |
cttgagtggtatc |
247 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28232779 |
cttgagtggtatc |
28232791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 28232557 - 28232640
Alignment:
| Q |
20 |
ccaaattcacattccaaaagtgattc-ttcccttcttttccttcttagtgttcctcaaacacatgagtgtaagaggagctagag |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28232557 |
ccaaattcacattccaaaagtgattccttcccttcttttccttctttgtgttcctcaaacacatgagtgtaagaggagctagag |
28232640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University