View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6956_low_9 (Length: 243)
Name: NF6956_low_9
Description: NF6956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6956_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 13784889 - 13784666
Alignment:
| Q |
13 |
gataaggcagtgcagaagaaagagaaaccacaggtttgtttgtgtgt--tagtgttactacaatatatacacggaacgcgatgccttcaactaccgtcta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13784889 |
gataaggcagtgcagaagaaagagaaaccacaggtttgtttgtgtgtgttagtgttactacagtatatacacggaacgcgatcccttcaactaccgtcta |
13784790 |
T |
|
| Q |
111 |
gtctcgttcttcnnnnnnncaggcttacttttggaattttgctattctcactttgatttttcttcattcacacatgaaatttaccttgttaatttgatga |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13784789 |
gtctcgttcttcttttttt-aggcttacttttggaattttgctattctcactttgatttttcttcattcacacatgaaatttaccttgttaattccatga |
13784691 |
T |
|
| Q |
211 |
atatgctcttccctcaacaccaaac |
235 |
Q |
| |
|
||||||| ||||||| |||| |||| |
|
|
| T |
13784690 |
atatgcttttccctcgacacaaaac |
13784666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 185
Target Start/End: Complemental strand, 13782161 - 13782107
Alignment:
| Q |
131 |
aggcttacttttggaattttgctattctcactttgatttttcttcattcacacat |
185 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
13782161 |
aggcttacttttggaatttttctattctcactttgattttagttcattcacacat |
13782107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 65 - 107
Target Start/End: Complemental strand, 13783481 - 13783439
Alignment:
| Q |
65 |
ttactacaatatatacacggaacgcgatgccttcaactaccgt |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13783481 |
ttactacaatatatacacggaacgtgatgccttcaactaccgt |
13783439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University