View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6957_low_13 (Length: 208)
Name: NF6957_low_13
Description: NF6957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6957_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 59 - 193
Target Start/End: Original strand, 48923394 - 48923528
Alignment:
| Q |
59 |
tgattattgagcaacttgaaggagcgttgagggagtgagtgagtggtgggtgtgtatgtttctgactaaaacccacatcggttagtgcttaaatcaaact |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48923394 |
tgattattgagcaacttgaaggagcgttgagggagtgagtgagtggtgggtgtgtatgtttctgactaaaacccacatcggttagtgcttaaatcaaact |
48923493 |
T |
 |
| Q |
159 |
agaccgctcaagctataaatataaatggacttact |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48923494 |
agaccgctcaagctataaatataaatggacttact |
48923528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University